Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

The following protocol combines highly multiplexed protein marker detection with unbiased transcriptome profiling for thousands of single cells. Epitope detection is enabled by BioLegend's TotalSeq™ antibody-oligo conjugates. TotalSeq™ reagents are compatible with Cellular Indexing of Transcriptomes and Epitopes by sequencing (CITE-seq), RNA Expression And Protein sequencing assay (REAP-seq), and similar workflows.

Please read the entire protocol before starting the experiments.

Reagent and Instrument List

All items listed, or equivalent, are required.

Researchers are advised to validate equivalent products when substituting the above recommendations.

Protocol

I) Cell staining for Drop-seq or 10x Genomics platforms

1. Carefully count all cells to ensure accurate quantitation.
   • Make note of cell viability (>95%) and also include dead cells in the total cell count.
   • If high cell death is observed, live cell enrichment (e.g. by Flow Cytometry) is recommended.


2. Resuspend 1-2 million cells in 100 µl Cell Staining Buffer.  


3. Add 5 µl of Human TruStain FcX™ Fc Blocking reagent.  


4. Incubate for 5 – 10 minutes at 4°C.


5. While cells are incubating in Fc Block, prepare antibody-pool using 1 µg (or titrated amounts) of each TotalSeq™ and/or hashtag or biotinylated antibody.  


6. To maximize performance, centrifuge the antibody pool at 14,000xg at 2 - 8°C for 10 minutes before adding to the cells.   


7. Carefully pipette out the liquid, avoiding the bottom of the tube, and add the TotalSeq™ antibody cocktail to the cell suspension.   


8. Incubate for 30 minutes at 4°C.


9. Wash cells 2 times with 1 mL PBS, spin 5 minutes 350g at 4°C.
   *Please note that it has been observed in some cases that various factors, including cell/sample type, tube manufacturer, rotor type, wash buffer, etc., may result in an excessive number of cells coating the side of the tube. Please ensure that staining and washing conditions are appropriate for your sample type.


10. If using biotinylated antibodies, incubate with the appropriate oligo barcoded streptavidin at the recommended amount specified in the product technical datasheet for 20 minutes.


11. Wash cells 2 times with 1 mL PBS, spin 5 minutes 350g at 4°C.


12. Resuspend cells in PBS at appropriate concentration for downstream application. (e.g. for 10x Genomics 500 cells/µl; for Drop-seq 200 cells/µl).  


13. Filter cells through 40 µm strainers.  


14. Verify cell concentration by counting on hemocytometer after filtration.  

II) Run Drop-seq (Macosko et al., 2015) or 10x Genomics single cell 3’ v2 assay as described until before cDNA amplification.

At cDNA amplification step:

Add “additive” primers (0.2 µM) to cDNA PCR to increase yield of Antibody Derived Tag (ADT, cDNA derived from the TotalSeq™ antibodies) products, 1 µl (for 10x Genomics) or 0.4 µl (for Drop-seq). See notes at the end of the protocol for further details. Subtract the total volume of additive primer from the water added to the PCR reaction.

Please see example table below of 10X cDNA amplification reaction table (section 2.2, Chromium Single Cell 3’ v2 Reagent Kit, Quick Reference Card (v2 Chemistry))

See notes at the end of the protocol for further details on primer sequences.

III) ADT and mRNA library preparation

A) After cDNA amplification: Separate ADT-derived cDNAs (180bp) and mRNA-derived cDNAs (>300bp).

1. Perform sparQ or SPRI selection to separate mRNA-derived and ADT cDNAs. Follow manufacture’s recommendations.  

2. Do not discard supernatant from 0.6X sparQ or SPRI. This contains the ADTs.

• Add 0.6X sparQ or SPRI (60 µl, based on 100 µl sample volume) to cDNA reaction as described in 10x Genomics or Drop-seq protocol.
• Incubate 5 minutes and place on magnet.
• Supernatant contains ADTs.
• Beads contain full length mRNA-derived cDNAs.

B) mRNA-derived cDNA >300bp (beads fraction).

Proceed with standard 10x Genomics or Drop-seq protocol for cDNA sequencing library preparation.

C) ADTs 180bp (supernatant fraction).

1) Purify ADTs using two 2X sparQ or SPRI purifications per manufacturer protocol

• Add 1.4X sparQ or SPRI (140 µl, based on 100 µl sample volume) to supernatant to obtain a final sparQ or SPRI volume of 2X sparQ or SPRI.  

• Transfer entire volume into a low-bind 1.5mL tube.  

• Incubate 10 minutes at room temperature.

• Place tube on magnet and wait 2 minutes until solution is clear.

• Carefully remove and discard the supernatant.  

• Add 400 µl 80% Ethanol to the tube without disturbing the pellet and stand for 30 seconds (only one Ethanol wash).

• Carefully remove and discard the ethanol wash.  

• Centrifuge tube briefly and return it to magnet.  

• Remove and discard any remaining ethanol.  

• Resuspend beads in 50 µl water.  

• Perform another round of 2X sparQ or SPRI purification by adding 100 µl sparQ or SPRI reagent directly onto resuspended beads.  

• Mix by pipetting, and incubate 10 minutes at room temperature.

• Place tube on magnet and wait 2 minutes until solution is clear.

• Carefully remove and discard the supernatant.  

• Add 200 µl 80% Ethanol to the tube without disturbing the pellet and stand for 30 seconds (1st Ethanol wash).

• Carefully remove and discard the ethanol wash.  

• Add 200 µl 80% Ethanol to the tube without disturbing the pellet and stand for 30 seconds (2nd Ethanol wash).

• Carefully remove and discard the ethanol wash.  

• Centrifuge tube briefly and return it to magnet.  

• Remove and discard any remaining ethanol and allow the beads to air dry for 2 minutes (do not over dry beads).

• Resuspend beads in 45 µl water.  

• Pipette mix vigorously and incubate at room temperature for 5 minutes.

• Place tube on magnet and transfer clear supernatant into PCR tube.  

2) Amplify ADT sequencing library

Prepare 100µL PCR reaction with purified ADTs. For primer sequences please see "Notes" at the end of the protocol:

• 45 µl purified ADT fraction

• 50 µl KAPA HiFi HotStart ReadyMix (2X).

• 2.5 µl Truseq Small RNA RPIx primer (containing i7 index) 10 µM.

• 2.5 µl P5 oligo at 10 µM depending on application:
  • For Drop-seq use P5-SMART-PCR hybrid oligo.
  • For 10X use SI PCR oligo.

3) Purify PCR product using 1.6X sparQ or SPRI purification by adding 160 µl sparQ or SPRI reagent.

• Incubate 5 minutes at room temperature.

• Place tube on magnet and wait 1 minute until solution is clear.

• Carefully remove and discard the supernatant.  

• Add 200 µl 80% Ethanol to the tube without disturbing the pellet and stand for 30 seconds (first Ethanol wash).

• Carefully remove and discard the ethanol wash.  

• Add 200 µl 80% Ethanol to the tube without disturbing the pellet and stand for 30 seconds (second Ethanol wash).

• Carefully remove and discard the ethanol wash.  

• Centrifuge tube briefly and return it to magnet.  

• Remove and discard any remaining ethanol and allow the beads to air dry for 2 minutes.

• Resuspend beads in 20 µl water.  

• Pipette mix vigorously and incubate at room temperature for 5 minutes.

• Place tube on magnet and transfer clear supernatant to PCR tube.  

4) ADT libraries are now ready to be sequenced.

• Quantify libraries by standard methods (QuBit, BioAnalyzer, qPCR).  

• ADT libraries will be around 180 bp (Figure 1).  

IV) Sequencing CITE-seq libraries:

We estimate that an average of 100 molecules per ADT per cell is sufficient to achieve useful information. The number of reads required to obtain 100 molecules depends on the complexity of the sequencing library (e.g. duplication rate). ADT and mRNA cDNA sequencing libraries can be pooled at desired proportions. To obtain sufficient read coverage for both libraries we typically sequence ADT libraries in 5-10% of a lane and cDNA library fraction at 90% of a lane (HiSeq2500 Rapid Run Mode Flowcell).

Notes:

Oligonuleotide sequences:

TotalSeq™ antibodies. Each clone is barcoded with a unique oligonucleotide sequence. These contain standard small TruSeq RNA read 2 sequences and can be amplified using Illumina'’'s Truseq Small RNA primer sets (RPIx – primers, see example RPI1 below)

CCTTGGCACCCGAGAATTCCAAACAAGACCCTTGAGBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Please visit https://www.biolegend.com/totalseq for detailed information:

Oligos required for ADT library amplification:

• Drop-seq P5-SMART-PCR hybrid primer (for Drop-seq only) 5’AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGT*A*C
• 10x Genomics SI-PCR primer (for 10x Single Cell) 5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGC*T*C
• ADT cDNA PCR additive primer 5’CCTTGGCACCCGAGAATT*C*C
• Illumina Small RNA RPI1 primer (for ADT amplification; i7 index 1, Oligonucleotide sequences, Illumina) 5’CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A
  
  * indicates a phosphorothioate bond
  B indicates C or G or T; not A nucleotide

Figure 1. ADT library verification. (left graph) A TSO-RT-oligo product (~140 bp) can be amplified during the ADT PCR by carryover primers from cDNA amplification. The product will not cluster but will interfere with quantification. Sequential 2X sparQ or SPRI purification of the ADT fraction after cDNA amplification reduces carryover of primers from cDNA amplification, and minimizes the amplification of this product during ADT-library amplification. To further enrich for ADT specific product the purified ADT library can be reamplified for 3 additional cycles with ADT specific primer sets or P5/P7 generic primers. (right graph) A clean ADT library will contain a predominant single peak at around 180 bp.